Review




Structured Review

Genlantis inc solubl21 e. coli cells
Solubl21 E. Coli Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/e++coli+solubl21/us12269866-253-0-4
Average 90 stars, based on 1 article reviews
solubl21 e. coli cells - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

Plasmid Preparation:

Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells
Article Snippet: .. The resulting plasmid was transformed into E. coli SoluBL21 cells (Genlantis) and used to induce the protein expression in vitro. .. Recombinant GbX was purified by Ni-nitrilotriacetic acid (Ni-NTA) agarose chromatography using an AKTA Purifier 10 FPLC system (GE Healthcare) with UNICORN software.

Transformation Assay:

Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells
Article Snippet: .. The resulting plasmid was transformed into E. coli SoluBL21 cells (Genlantis) and used to induce the protein expression in vitro. .. Recombinant GbX was purified by Ni-nitrilotriacetic acid (Ni-NTA) agarose chromatography using an AKTA Purifier 10 FPLC system (GE Healthcare) with UNICORN software.

Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones
Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown.

Expressing:

Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells
Article Snippet: .. The resulting plasmid was transformed into E. coli SoluBL21 cells (Genlantis) and used to induce the protein expression in vitro. .. Recombinant GbX was purified by Ni-nitrilotriacetic acid (Ni-NTA) agarose chromatography using an AKTA Purifier 10 FPLC system (GE Healthcare) with UNICORN software.

Article Title: Analysis of chronic inflammatory lesions of the colon for BMMF Rep antigen expression and CD68 macrophage interactions
Article Snippet: Purification of the H1MSB.1 Rep protein: The Rep gene (CDS63398.1, nt602-1576) of H1MSB.1 (previously MSBI1.176, accession number LK931491.1) was TA-cloned into the pEXP-5-CT overexpression plasmid (Invitrogen) by PCR (forward primer: ATGAGCGATTTAATAGTAAAAGATAACGCC, reverse primer: AAAAACCACGCCAAACTCCTCC) and integration validated by sequencing. .. Expression of the H1MSB.1 Rep-6xHis in E. coli SoluBL21 cells (Genlantis) was performed for 24 h at 37 °C (in LB-Amp) and induced with 0.66 mM Isopropyl β-D-1thiogalactopyranoside (IPTG). .. Cells were lysed in urea buffer (8 M urea, 100 mM NaH2PO4, 10 mM Tris, 5 mM imidazole, pH 8.0), sonified, and subjected to ion metal affinity chromatography purification under denaturing condition (IMAC, Ni60 slurry, Clontech).

In Vitro:

Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells
Article Snippet: .. The resulting plasmid was transformed into E. coli SoluBL21 cells (Genlantis) and used to induce the protein expression in vitro. .. Recombinant GbX was purified by Ni-nitrilotriacetic acid (Ni-NTA) agarose chromatography using an AKTA Purifier 10 FPLC system (GE Healthcare) with UNICORN software.

Inhibition:

Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones
Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown.

Recombinant:

Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones
Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown.

Synthesized:

Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones
Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown.

other:

Article Title: Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme
Article Snippet: PAPS-red A for electrophoretic mobility shift assays (EMSA) and protein binding microarray (PBM) experiments was expressed in auto-induced E.coli SoluBL21TM cells (Genlantis) as a glutathione-S transferase (GST) fusion, purified by affinity chromatography on a Glutathione SepharoseTM 4B column (GE Healthcare) following the manufacturer’s instructions, and exchanged into 10 mM Tris-HCl pH 8.0 buffer containing 120 mM KCl and 1 mM DTT.



Similar Products

96
AMS Biotechnology e coli strain solubl21 cells
E Coli Strain Solubl21 Cells, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/SoluBL21+Electrocompetent+E%2E+coli/bio_rxiv__64898__2026__02__11__705390-210-0-5
Average 96 stars, based on 1 article reviews
e coli strain solubl21 cells - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
AMS Biotechnology e coli solubl21 cells
E Coli Solubl21 Cells, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/SoluBL21+Electrocompetent+E%2E+coli/pm41461644-202-6-10
Average 96 stars, based on 1 article reviews
e coli solubl21 cells - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
AMS Biotechnology solubl21 e coli cells
Solubl21 E Coli Cells, supplied by AMS Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/SoluBL21+Electrocompetent+E%2E+coli/pm41115859-373-0-4
Average 96 stars, based on 1 article reviews
solubl21 e coli cells - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

90
Genlantis inc solubl21 e. coli cells
Solubl21 E. Coli Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/e++coli+solubl21/us12269866-253-0-4
Average 90 stars, based on 1 article reviews
solubl21 e. coli cells - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Genlantis inc e. coli solubl21 (de3) cells
E. Coli Solubl21 (De3) Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/e++coli+solubl21/pmc11720379__ANIE___64___e202414162___s001-32-10-15
Average 90 stars, based on 1 article reviews
e. coli solubl21 (de3) cells - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Genlantis inc solubl21 e. coli cells containing the pet28-ngbh64q plasmid
Solubl21 E. Coli Cells Containing The Pet28 Ngbh64q Plasmid, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/e++coli+solubl21/us11845785-252-7-4
Average 90 stars, based on 1 article reviews
solubl21 e. coli cells containing the pet28-ngbh64q plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Genlantis inc solubl21 e coli cells
Solubl21 E Coli Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/us11845785-252-0-4
Average 93 stars, based on 1 article reviews
solubl21 e coli cells - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Genlantis inc solubl21 cells
Solubl21 Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/SoluBL21+Electrocompetent+E%2E+coli/pmc10721929-354-5-7
Average 93 stars, based on 1 article reviews
solubl21 cells - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results