solubl21 e. coli cells (Genlantis inc)
90
Structured Review
Genlantis inc
solubl21 e. coli cells
Solubl21 E. Coli Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/e++coli+solubl21/us12269866-253-0-4
Average 90 stars, based on 1 article reviews
Solubl21 E. Coli Cells, supplied by Genlantis inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/e+coli+solubl21+cells/e++coli+solubl21/us12269866-253-0-4
Average 90 stars, based on 1 article reviews
solubl21 e. coli cells - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells Article Snippet: .. The resulting plasmid was transformed into Transformation Assay:Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells Article Snippet: .. The resulting plasmid was transformed into Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown. Expressing:Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells Article Snippet: .. The resulting plasmid was transformed into Article Title: Analysis of chronic inflammatory lesions of the colon for BMMF Rep antigen expression and CD68 macrophage interactions Article Snippet: Purification of the H1MSB.1 Rep protein: The Rep gene (CDS63398.1, nt602-1576) of H1MSB.1 (previously MSBI1.176, accession number LK931491.1) was TA-cloned into the pEXP-5-CT overexpression plasmid (Invitrogen) by PCR (forward primer: ATGAGCGATTTAATAGTAAAAGATAACGCC, reverse primer: AAAAACCACGCCAAACTCCTCC) and integration validated by sequencing. .. Expression of the H1MSB.1 Rep-6xHis in In Vitro:Article Title: Globin X is a six-coordinate globin that reduces nitrite to nitric oxide in fish red blood cells Article Snippet: .. The resulting plasmid was transformed into Inhibition:Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown. Recombinant:Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown. Synthesized:Article Title: Structural and thermodynamic analyses of interactions between death-associated protein kinase 1 and anthraquinones Article Snippet: Death-associated protein kinase 1 (DAPK1) is a serine/threonine protein kinase that regulates apoptosis and autophagy.. DAPK1 is considered to be a therapeutic target for amyloiddeposition, endometrial adenocarcinomas and acute ischemic stroke.. Here, the potent inhibitory activity of the natural anthraquinone purpurin against DAPK1 phosphorylation is shown. other:Article Title: Moonlighting transcriptional activation function of a fungal sulfur metabolism enzyme Article Snippet: PAPS-red A for electrophoretic mobility shift assays (EMSA) and protein binding microarray (PBM) experiments was expressed in |